Linum usitatissimum mRNA modification sites

Chr	Position	Strand	Ref_nt	Pred_mod	H1_Pval	H4_Pval	Gene	Feature	Data_type	Data_Acc
scaffold262	397134	NA	T The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below TGCTTAACGGCGGCCGTAACTATAACGGTCCTAAGGTAGCG	Y	0	1.49E-15	NA	NA	mRNAseq	SRR1056619
scaffold3956	6062	NA	A The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below CCTGTCTCACGACGGTCTAAACCCAGCTCACGTTCCCTATT	i6A\|t6A	2.53E-75	0.00135146	NA	NA	mRNAseq	SRR1056619