Citrus sinensis mRNA modification sites

Chr	Position	Strand	Ref_nt	Pred_mod	H1_Pval	H4_Pval	Gene	Feature	Data_type	Data_Acc
scaffold00001	151281	+	T The 20-nt upstream and downstream sequence around the modification site is shown below GCTTAACCGTTACGGTGGGGTATTCGTGCACAAGCATCCTC	D	1.49E-16	0.047280785	orange1.1g006722m.v1.1	mRNA	Degradome	GSM1138346
scaffold00002	787472	+	C The 20-nt upstream and downstream sequence around the modification site is shown below CGGCTACTCTGATACAGCCACCGGCTACTCTGATACCCCCA	m3C	7.19E-35	0.028351704	orange1.1g033354m.v1.1.CDS.1	exon	Degradome	GSM1138347
scaffold00002	1637069	+	G The 20-nt upstream and downstream sequence around the modification site is shown below GGGGAGAGTACTACACGAGCGTGAATTTTGTGTTGATTTGC	m1G	1.86E-22	0.016970183	orange1.1g009270m.v1.1	mRNA	Degradome	GSM1138345
scaffold00003	3541370	+	G The 20-nt upstream and downstream sequence around the modification site is shown below GCCGAGGCCAACCCGTTCCCGTTCTTTTCATGTTCCTCAGT	m2G\|m22G	2.89E-27	0.012607485	orange1.1g030727m.v1.1	mRNA	Degradome	GSM1138345
scaffold00004	1707179	+	T The 20-nt upstream and downstream sequence around the modification site is shown below CAGTGCCCGGGCCAATGCGCTTGGCCATTTCACCAGCCCAT	D	1.65E-55	0.010044256	orange1.1g020726m.v1.1	mRNA	Degradome	GSM1138345
scaffold00018	1187031	-	G The 20-nt upstream and downstream sequence around the modification site is shown below AATCTAGGGTTTTTCGCTCCGTTGCAAGAACTGCTGAAAGA	m3C	2.35E-85	5.70E-10	orange1.1g035463m.v1.1	mRNA	Degradome	GSM1138347
scaffold00021	750232	+	C The 20-nt upstream and downstream sequence around the modification site is shown below GCAATCATCTACAACAAGGACCGCGGTTGGGATGACCACGT	m3C	1.54E-55	2.92E-12	orange1.1g021798m.v1.1.CDS.3	exon	Degradome	GSM1138347
scaffold00023	1033063	-	G The 20-nt upstream and downstream sequence around the modification site is shown below ATCATTCAAGTCAGCAATCTGGTTCTGGATGACTGCACAGC	m3C	2.47E-35	0.016834483	orange1.1g026315m.v1.1.CDS.3	exon	Degradome	GSM1138345
scaffold00023	1033063	-	G The 20-nt upstream and downstream sequence around the modification site is shown below ATCATTCAAGTCAGCAATCTGGTTCTGGATGACTGCACAGC	m3C	2.99E-155	2.35E-08	orange1.1g026315m.v1.1.CDS.3	exon	Degradome	GSM1138346
scaffold00032	450884	+	A The 20-nt upstream and downstream sequence around the modification site is shown below TTGTAGGTTTCGTGTACTGGAACATAAACTTGTTATCAGGT	m1A\|m1I\|ms2i6A	3.96E-170	4.98E-17	orange1.1g045264m.g.v1.1	mRNA	Degradome	GSM1138347
scaffold00043	392155	+	T The 20-nt upstream and downstream sequence around the modification site is shown below GATTTTGAGGCTACGCCTGGTCTTACCCAGCACAAGAAAAA	Y	5.60E-85	2.47E-06	orange1.1g041279m.g.v1.1	mRNA	mRNAseq	SRR4050294
scaffold00043	392155	+	T The 20-nt upstream and downstream sequence around the modification site is shown below GATTTTGAGGCTACGCCTGGTCTTACCCAGCACAAGAAAAA	Y	8.34E-82	0.001384341	orange1.1g041279m.v1.1.CDS.2	exon	mRNAseq	SRR4050295
scaffold00061	96270	+	T The 20-nt upstream and downstream sequence around the modification site is shown below GCCATAGAGGAAGGTATTGTTCCTGGTGGTGGTGCTGCTCT	D	1.73E-24	0.012607485	orange1.1g011926m.v1.1.CDS.4	exon	Degradome	GSM1138345
scaffold00061	231618	-	G The 20-nt upstream and downstream sequence around the modification site is shown below CTGATTGAAAGAAGATCACTGTAGGATGAATTTGAAGACAA	m3C	3.97E-75	1.04E-16	orange1.1g007982m.g.v1.1	mRNA	Degradome	GSM1138347
scaffold00062	489549	-	G The 20-nt upstream and downstream sequence around the modification site is shown below GCTAGCTCATCCTGCCACCGGAGCATTTTGGACACATTGTG	m3C	1.66E-79	0.000113766	orange1.1g012543m.v1.1.CDS.2	exon	Degradome	GSM1138347
scaffold00112	392927	+	A The 20-nt upstream and downstream sequence around the modification site is shown below TTATTTTACTCCTATTATTTATATTATTTTCCTTTGTCCAA	m1A\|m1I\|ms2i6A	3.20E-27	0.001399394	orange1.1g034843m.g.v1.1	mRNA	mRNAseq	SRR4050292
scaffold00163	21397	-	G The 20-nt upstream and downstream sequence around the modification site is shown below TGTTCAAGTCTATAAAAATTGAACATTAGATCTGAAGGGTT	m3C	1.32E-235	5.40E-42	orange1.1g017269m.v1.1.5UTR.1	5UTR	Degradome	GSM1138347
scaffold00193	5239	-	T The 20-nt upstream and downstream sequence around the modification site is shown below TGTTGTTGATAGAAAATGGATCCAATATCCATCGGCAGGGG	i6A\|t6A	0	1.25E-41	orange1.1g020245m.g.v1.1	mRNA	mRNAseq	SRR4050294
scaffold00193	5239	-	T The 20-nt upstream and downstream sequence around the modification site is shown below TGTTGTTGATAGAAAATGGATCCAATATCCATCGGCAGGGG	i6A\|t6A	0	3.91E-64	orange1.1g020245m.v1.1	mRNA	mRNAseq	SRR4050295
scaffold00193	5645	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CCAGAAGCTCGCATGCAATTACCATAGTAGGACAAAAGGTC	Y	0	9.96E-83	orange1.1g020245m.v1.1	mRNA	mRNAseq	SRR4050294
scaffold00193	5645	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CCAGAAGCTCGCATGCAATTACCATAGTAGGACAAAAGGTC	Y	0	2.16E-71	orange1.1g020245m.g.v1.1	mRNA	mRNAseq	SRR4050295
scaffold00270	172768	-	G The 20-nt upstream and downstream sequence around the modification site is shown below ATGGTAGTCACATTCGGTCCGTCTGGATTGACTACGGAAGT	m3C	0	1.53E-48	orange1.1g013237m.g.v1.1	mRNA	Degradome	GSM1138347
scaffold00280	114014	-	G The 20-nt upstream and downstream sequence around the modification site is shown below ATGGCAAATGAGATTCGACAGTTCGTGCTGAACACCGGAGC	m3C	1.19E-27	0.012028704	orange1.1g021241m.v1.1	mRNA	Degradome	GSM1138346
scaffold00354	155036	-	T The 20-nt upstream and downstream sequence around the modification site is shown below AGTTATTCTACTCCACCTCTTAGAAAGCAAAGAACTTAGTG	i6A\|t6A	1.14E-30	0.003959932	orange1.1g019334m.g.v1.1	mRNA	Degradome	GSM1138346
scaffold00354	155052	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CATTGCGCTTCAACCAAGTTATTCTACTCCACCTCTTAGAA	Y	0	1.03E-16	orange1.1g019334m.g.v1.1	mRNA	Degradome	GSM1138345
scaffold00547	100678	-	C The 20-nt upstream and downstream sequence around the modification site is shown below CTCAAACATGTACGTGAATCCGAAGTGAAGGCTTCAATCCA	m1G	9.82E-33	0.036029427	orange1.1g048689m.v1.1.CDS.1	exon	mRNAseq	SRR4050292
scaffold00564	73526	+	C The 20-nt upstream and downstream sequence around the modification site is shown below GGATCTTCTTTTGTCAGATTCGGCACGTTGGCAGGGTTTCA	m3C	8.01E-31	0.04505508	orange1.1g015862m.v1.1.CDS.3	exon	mRNAseq	SRR4050295
scaffold00564	75510	+	A The 20-nt upstream and downstream sequence around the modification site is shown below GCAAACTATATGGAATCAGGAGACTCTAACCCAGAAGCTTT	i6A\|t6A	8.34E-143	1.07E-08	orange1.1g015862m.v1.1	mRNA	mRNAseq	SRR4050294
scaffold00564	75510	+	A The 20-nt upstream and downstream sequence around the modification site is shown below GCAAACTATATGGAATCAGGAGACTCTAACCCAGAAGCTTT	i6A\|t6A	2.53E-114	2.03E-15	orange1.1g015862m.g.v1.1	mRNA	mRNAseq	SRR4050295
scaffold01098	23793	+	A The 20-nt upstream and downstream sequence around the modification site is shown below AATCATTCGAAGATTTTCCGATCTATAGAGCAAGTGTTGAC	i6A\|t6A	7.42E-31	0.000212008	orange1.1g045960m.v1.1.CDS.3	exon	mRNAseq	SRR4050293
scaffold01522	19502	+	C The 20-nt upstream and downstream sequence around the modification site is shown below TCTGGCTCGATCAACTCAGACACGCATGTTACGACATGGAA	m3C	1.19E-35	0.007929296	orange1.1g002187m.g.v1.1	mRNA	mRNAseq	SRR4050295
scaffold01522	19502	+	C The 20-nt upstream and downstream sequence around the modification site is shown below TCTGGCTCGATCAACTCAGACACGCATGTTACGACATGGAA	m3C	2.66E-54	4.47E-06	orange1.1g002187m.v1.1.CDS.1	exon	mRNAseq	SRR4050293
scaffold01950	1215	+	T The 20-nt upstream and downstream sequence around the modification site is shown below CAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA	Y	1.29E-220	1.00E-23	orange1.1g036658m.g.v1.1	mRNA	mRNAseq	SRR4050292
scaffold01950	1215	+	T The 20-nt upstream and downstream sequence around the modification site is shown below CAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA	Y	1.83E-122	5.48E-06	orange1.1g036658m.g.v1.1	mRNA	mRNAseq	SRR4050293
scaffold01950	1215	+	T The 20-nt upstream and downstream sequence around the modification site is shown below CAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA	Y	1.01E-173	7.52E-14	orange1.1g036658m.g.v1.1	mRNA	mRNAseq	SRR4050294
scaffold01950	1215	+	T The 20-nt upstream and downstream sequence around the modification site is shown below CAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA	Y	5.01E-160	1.10E-18	orange1.1g036658m.v1.1	mRNA	mRNAseq	SRR4050295
scaffold03685	847	NA	G The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below ATTTCATTATTGGATCCTCGGCACATCCTCATCCACCTGCA	m1G	2.26E-47	0.005277423	NA	NA	mRNAseq	SRR4050292
scaffold04536	802	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT	D	0	3.85E-73	orange1.1g023384m.v1.1	mRNA	mRNAseq	SRR4050292
scaffold04536	802	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT	D	0	1.45E-65	orange1.1g023384m.g.v1.1	mRNA	mRNAseq	SRR4050293
scaffold04536	802	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT	D	2.51924072814452e-320	2.37E-24	orange1.1g023384m.v1.1	mRNA	mRNAseq	SRR4050294
scaffold04536	802	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT	D	2.81E-295	9.75E-24	orange1.1g023384m.v1.1	mRNA	mRNAseq	SRR4050295
scaffold05643	3240	-	C The 20-nt upstream and downstream sequence around the modification site is shown below TGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG	m1G	1.79E-53	0.003535751	orange1.1g048439m.v1.1	mRNA	mRNAseq	SRR4050292
scaffold05643	3240	-	C The 20-nt upstream and downstream sequence around the modification site is shown below TGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG	m1G	4.75E-57	0.000758032	orange1.1g048439m.v1.1	mRNA	mRNAseq	SRR4050293
scaffold05643	3240	-	C The 20-nt upstream and downstream sequence around the modification site is shown below TGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG	m1G	3.49E-36	0.039097118	orange1.1g048439m.v1.1	mRNA	mRNAseq	SRR4050295
scaffold06582	1967	NA	T The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below GGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA	D	3.72E-241	3.03E-31	NA	NA	mRNAseq	SRR4050292
scaffold06582	1967	NA	T The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below GGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA	D	3.70E-230	3.57E-21	NA	NA	mRNAseq	SRR4050293
scaffold06582	1967	NA	T The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below GGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA	D	1.13E-91	2.14E-09	NA	NA	mRNAseq	SRR4050294
scaffold06582	1967	NA	T The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below GGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA	D	3.43E-104	2.56E-19	NA	NA	mRNAseq	SRR4050295
scaffold11354	2094	NA	C The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below TGTATCTCATATCTGTATCACTGTATCTTTGTATCTCAATA	m3C	1.80E-31	0.003016646	NA	NA	mRNAseq	SRR4050293
scaffold12515	582	-	G The 20-nt upstream and downstream sequence around the modification site is shown below AGGCTACACTTTGGGCTGTGGCTTTCTCCATTGCTTTCTCT	m3C	4.59E-36	0.000184169	orange1.1g037705m.v1.1.CDS.1	exon	mRNAseq	SRR4050292

Citrus sinensis mRNA modification sites

The 20-nt upstream and downstream sequence around the modification site is shown belowGCTTAACCGTTACGGTGGGGTATTCGTGCACAAGCATCCTC

The 20-nt upstream and downstream sequence around the modification site is shown belowCGGCTACTCTGATACAGCCACCGGCTACTCTGATACCCCCA

The 20-nt upstream and downstream sequence around the modification site is shown belowGGGGAGAGTACTACACGAGCGTGAATTTTGTGTTGATTTGC

The 20-nt upstream and downstream sequence around the modification site is shown belowGCCGAGGCCAACCCGTTCCCGTTCTTTTCATGTTCCTCAGT

The 20-nt upstream and downstream sequence around the modification site is shown belowCAGTGCCCGGGCCAATGCGCTTGGCCATTTCACCAGCCCAT

The 20-nt upstream and downstream sequence around the modification site is shown belowAATCTAGGGTTTTTCGCTCCGTTGCAAGAACTGCTGAAAGA

The 20-nt upstream and downstream sequence around the modification site is shown belowGCAATCATCTACAACAAGGACCGCGGTTGGGATGACCACGT

The 20-nt upstream and downstream sequence around the modification site is shown belowATCATTCAAGTCAGCAATCTGGTTCTGGATGACTGCACAGC

The 20-nt upstream and downstream sequence around the modification site is shown belowATCATTCAAGTCAGCAATCTGGTTCTGGATGACTGCACAGC

The 20-nt upstream and downstream sequence around the modification site is shown belowTTGTAGGTTTCGTGTACTGGAACATAAACTTGTTATCAGGT

The 20-nt upstream and downstream sequence around the modification site is shown belowGATTTTGAGGCTACGCCTGGTCTTACCCAGCACAAGAAAAA

The 20-nt upstream and downstream sequence around the modification site is shown belowGATTTTGAGGCTACGCCTGGTCTTACCCAGCACAAGAAAAA

The 20-nt upstream and downstream sequence around the modification site is shown belowGCCATAGAGGAAGGTATTGTTCCTGGTGGTGGTGCTGCTCT

The 20-nt upstream and downstream sequence around the modification site is shown belowCTGATTGAAAGAAGATCACTGTAGGATGAATTTGAAGACAA

The 20-nt upstream and downstream sequence around the modification site is shown belowGCTAGCTCATCCTGCCACCGGAGCATTTTGGACACATTGTG

The 20-nt upstream and downstream sequence around the modification site is shown belowTTATTTTACTCCTATTATTTATATTATTTTCCTTTGTCCAA

The 20-nt upstream and downstream sequence around the modification site is shown belowTGTTCAAGTCTATAAAAATTGAACATTAGATCTGAAGGGTT

The 20-nt upstream and downstream sequence around the modification site is shown belowTGTTGTTGATAGAAAATGGATCCAATATCCATCGGCAGGGG

The 20-nt upstream and downstream sequence around the modification site is shown belowTGTTGTTGATAGAAAATGGATCCAATATCCATCGGCAGGGG

The 20-nt upstream and downstream sequence around the modification site is shown belowCCAGAAGCTCGCATGCAATTACCATAGTAGGACAAAAGGTC

The 20-nt upstream and downstream sequence around the modification site is shown belowCCAGAAGCTCGCATGCAATTACCATAGTAGGACAAAAGGTC

The 20-nt upstream and downstream sequence around the modification site is shown belowATGGTAGTCACATTCGGTCCGTCTGGATTGACTACGGAAGT

The 20-nt upstream and downstream sequence around the modification site is shown belowATGGCAAATGAGATTCGACAGTTCGTGCTGAACACCGGAGC

The 20-nt upstream and downstream sequence around the modification site is shown belowAGTTATTCTACTCCACCTCTTAGAAAGCAAAGAACTTAGTG

The 20-nt upstream and downstream sequence around the modification site is shown belowCATTGCGCTTCAACCAAGTTATTCTACTCCACCTCTTAGAA

The 20-nt upstream and downstream sequence around the modification site is shown belowCTCAAACATGTACGTGAATCCGAAGTGAAGGCTTCAATCCA

The 20-nt upstream and downstream sequence around the modification site is shown belowGGATCTTCTTTTGTCAGATTCGGCACGTTGGCAGGGTTTCA

The 20-nt upstream and downstream sequence around the modification site is shown belowGCAAACTATATGGAATCAGGAGACTCTAACCCAGAAGCTTT

The 20-nt upstream and downstream sequence around the modification site is shown belowGCAAACTATATGGAATCAGGAGACTCTAACCCAGAAGCTTT

The 20-nt upstream and downstream sequence around the modification site is shown belowAATCATTCGAAGATTTTCCGATCTATAGAGCAAGTGTTGAC

The 20-nt upstream and downstream sequence around the modification site is shown belowTCTGGCTCGATCAACTCAGACACGCATGTTACGACATGGAA

The 20-nt upstream and downstream sequence around the modification site is shown belowTCTGGCTCGATCAACTCAGACACGCATGTTACGACATGGAA

The 20-nt upstream and downstream sequence around the modification site is shown belowCAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA

The 20-nt upstream and downstream sequence around the modification site is shown belowCAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA

The 20-nt upstream and downstream sequence around the modification site is shown belowCAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA

The 20-nt upstream and downstream sequence around the modification site is shown belowCAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown belowATTTCATTATTGGATCCTCGGCACATCCTCATCCACCTGCA

The 20-nt upstream and downstream sequence around the modification site is shown belowCAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT

The 20-nt upstream and downstream sequence around the modification site is shown belowCAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT

The 20-nt upstream and downstream sequence around the modification site is shown belowCAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT

The 20-nt upstream and downstream sequence around the modification site is shown belowCAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT

The 20-nt upstream and downstream sequence around the modification site is shown belowTGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG

The 20-nt upstream and downstream sequence around the modification site is shown belowTGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG

The 20-nt upstream and downstream sequence around the modification site is shown belowTGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown belowGGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown belowGGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown belowGGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown belowGGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown belowTGTATCTCATATCTGTATCACTGTATCTTTGTATCTCAATA

The 20-nt upstream and downstream sequence around the modification site is shown belowAGGCTACACTTTGGGCTGTGGCTTTCTCCATTGCTTTCTCT

The 20-nt upstream and downstream sequence around the modification site is shown below
GCTTAACCGTTACGGTGGGGTATTCGTGCACAAGCATCCTC

The 20-nt upstream and downstream sequence around the modification site is shown below
CGGCTACTCTGATACAGCCACCGGCTACTCTGATACCCCCA

The 20-nt upstream and downstream sequence around the modification site is shown below
GGGGAGAGTACTACACGAGCGTGAATTTTGTGTTGATTTGC

The 20-nt upstream and downstream sequence around the modification site is shown below
GCCGAGGCCAACCCGTTCCCGTTCTTTTCATGTTCCTCAGT

The 20-nt upstream and downstream sequence around the modification site is shown below
CAGTGCCCGGGCCAATGCGCTTGGCCATTTCACCAGCCCAT

The 20-nt upstream and downstream sequence around the modification site is shown below
AATCTAGGGTTTTTCGCTCCGTTGCAAGAACTGCTGAAAGA

The 20-nt upstream and downstream sequence around the modification site is shown below
GCAATCATCTACAACAAGGACCGCGGTTGGGATGACCACGT

The 20-nt upstream and downstream sequence around the modification site is shown below
ATCATTCAAGTCAGCAATCTGGTTCTGGATGACTGCACAGC

The 20-nt upstream and downstream sequence around the modification site is shown below
ATCATTCAAGTCAGCAATCTGGTTCTGGATGACTGCACAGC

The 20-nt upstream and downstream sequence around the modification site is shown below
TTGTAGGTTTCGTGTACTGGAACATAAACTTGTTATCAGGT

The 20-nt upstream and downstream sequence around the modification site is shown below
GATTTTGAGGCTACGCCTGGTCTTACCCAGCACAAGAAAAA

The 20-nt upstream and downstream sequence around the modification site is shown below
GATTTTGAGGCTACGCCTGGTCTTACCCAGCACAAGAAAAA

The 20-nt upstream and downstream sequence around the modification site is shown below
GCCATAGAGGAAGGTATTGTTCCTGGTGGTGGTGCTGCTCT

The 20-nt upstream and downstream sequence around the modification site is shown below
CTGATTGAAAGAAGATCACTGTAGGATGAATTTGAAGACAA

The 20-nt upstream and downstream sequence around the modification site is shown below
GCTAGCTCATCCTGCCACCGGAGCATTTTGGACACATTGTG

The 20-nt upstream and downstream sequence around the modification site is shown below
TTATTTTACTCCTATTATTTATATTATTTTCCTTTGTCCAA

The 20-nt upstream and downstream sequence around the modification site is shown below
TGTTCAAGTCTATAAAAATTGAACATTAGATCTGAAGGGTT

The 20-nt upstream and downstream sequence around the modification site is shown below
TGTTGTTGATAGAAAATGGATCCAATATCCATCGGCAGGGG

The 20-nt upstream and downstream sequence around the modification site is shown below
TGTTGTTGATAGAAAATGGATCCAATATCCATCGGCAGGGG

The 20-nt upstream and downstream sequence around the modification site is shown below
CCAGAAGCTCGCATGCAATTACCATAGTAGGACAAAAGGTC

The 20-nt upstream and downstream sequence around the modification site is shown below
CCAGAAGCTCGCATGCAATTACCATAGTAGGACAAAAGGTC

The 20-nt upstream and downstream sequence around the modification site is shown below
ATGGTAGTCACATTCGGTCCGTCTGGATTGACTACGGAAGT

The 20-nt upstream and downstream sequence around the modification site is shown below
ATGGCAAATGAGATTCGACAGTTCGTGCTGAACACCGGAGC

The 20-nt upstream and downstream sequence around the modification site is shown below
AGTTATTCTACTCCACCTCTTAGAAAGCAAAGAACTTAGTG

The 20-nt upstream and downstream sequence around the modification site is shown below
CATTGCGCTTCAACCAAGTTATTCTACTCCACCTCTTAGAA

The 20-nt upstream and downstream sequence around the modification site is shown below
CTCAAACATGTACGTGAATCCGAAGTGAAGGCTTCAATCCA

The 20-nt upstream and downstream sequence around the modification site is shown below
GGATCTTCTTTTGTCAGATTCGGCACGTTGGCAGGGTTTCA

The 20-nt upstream and downstream sequence around the modification site is shown below
GCAAACTATATGGAATCAGGAGACTCTAACCCAGAAGCTTT

The 20-nt upstream and downstream sequence around the modification site is shown below
GCAAACTATATGGAATCAGGAGACTCTAACCCAGAAGCTTT

The 20-nt upstream and downstream sequence around the modification site is shown below
AATCATTCGAAGATTTTCCGATCTATAGAGCAAGTGTTGAC

The 20-nt upstream and downstream sequence around the modification site is shown below
TCTGGCTCGATCAACTCAGACACGCATGTTACGACATGGAA

The 20-nt upstream and downstream sequence around the modification site is shown below
TCTGGCTCGATCAACTCAGACACGCATGTTACGACATGGAA

The 20-nt upstream and downstream sequence around the modification site is shown below
CAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA

The 20-nt upstream and downstream sequence around the modification site is shown below
CAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA

The 20-nt upstream and downstream sequence around the modification site is shown below
CAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA

The 20-nt upstream and downstream sequence around the modification site is shown below
CAGACTCCTTGGTCCGTGTTTCAAGACGGGGTGAATGGGGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below
ATTTCATTATTGGATCCTCGGCACATCCTCATCCACCTGCA

The 20-nt upstream and downstream sequence around the modification site is shown below
CAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT

The 20-nt upstream and downstream sequence around the modification site is shown below
CAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT

The 20-nt upstream and downstream sequence around the modification site is shown below
CAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT

The 20-nt upstream and downstream sequence around the modification site is shown below
CAATGCAGAGGAAGAGGAACACGAATTAACCGAAACAAAGT

The 20-nt upstream and downstream sequence around the modification site is shown below
TGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG

The 20-nt upstream and downstream sequence around the modification site is shown below
TGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG

The 20-nt upstream and downstream sequence around the modification site is shown below
TGGGAGTTCGAAGTGGATTCCGGCTTTACATATTTTCTGAG

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below
GGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below
GGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below
GGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below
GGGACTAGATTATGCATGCATAGATATGATGAGATATGAGA

The 20-nt upstream and downstream sequence around the modification site (genomic plus strand) is shown below
TGTATCTCATATCTGTATCACTGTATCTTTGTATCTCAATA

The 20-nt upstream and downstream sequence around the modification site is shown below
AGGCTACACTTTGGGCTGTGGCTTTCTCCATTGCTTTCTCT