Brachypodium distachyon mRNA modification sites

Chr	Position	Strand	Ref_nt	Pred_mod	H1_Pval	H4_Pval	Gene	Feature	Data_type	Data_Acc
Bd1	15203324	-	C The 20-nt upstream and downstream sequence around the modification site is shown below TAGGGTTCAACCATGTTTTACCGTCGGACTGTAGAACTTCG	m1G	3.26E-46	1.29E-06	Bradi1g18980.v3.1	mRNA	Degradome	GSE52441_stem
Bd1	15203325	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CTAGGGTTCAACCATGTTTTACCGTCGGACTGTAGAACTTC	D	1.78E-48	7.75E-14	Bradi1g18980.1.v3.1	mRNA	Degradome	GSE52441_stem
Bd1	40128440	-	T The 20-nt upstream and downstream sequence around the modification site is shown below AAAGCTTAAGTAGCGGCTACTGTTTTGAATGCATCAATATA	m1A\|m1I\|ms2i6A	0	1.41E-57	Bradi1g42670.1.v3.1.3UTR.1	3UTR	Degradome	GSE52441_stem
Bd2	4671115	+	T The 20-nt upstream and downstream sequence around the modification site is shown below TATCGTGTGGTCTTACTATCTATACTGGCGGAACGTCTCTT	Y	9.43E-72	3.02E-10	Bradi2g06220.1.v3.1	mRNA	Degradome	GSE52441_panicle
Bd2	4671115	+	T The 20-nt upstream and downstream sequence around the modification site is shown below TATCGTGTGGTCTTACTATCTATACTGGCGGAACGTCTCTT	Y	2.38208547232994e-310	1.34E-90	Bradi2g06220.1.v3.1.3UTR.1	3UTR	Degradome	GSE52441_stem
Bd2	16906526	+	G The 20-nt upstream and downstream sequence around the modification site is shown below GAGACAAGCATATGACTAGTGGCAGGATCAACCAGGTAGCA	m1G	3.32E-15	0.000481981	Bradi2g19209.1.v3.1.5UTR.1	5UTR	Degradome	GSE52441_leaf
Bd2	16906526	+	G The 20-nt upstream and downstream sequence around the modification site is shown below GAGACAAGCATATGACTAGTGGCAGGATCAACCAGGTAGCA	m1G	1.87E-18	0.006885797	Bradi2g19209.1.v3.1	mRNA	Degradome	GSE52441_panicle
Bd2	41300696	+	T The 20-nt upstream and downstream sequence around the modification site is shown below ATAGCTCGCAACTCCCTGTATGAAGAATGCATTCTTTCTAT	Y	1.90E-37	0.000227682	Bradi2g41270.1.v3.1	mRNA	Degradome	GSE52441_leaf
Bd2	58810768	+	T The 20-nt upstream and downstream sequence around the modification site is shown below AAATCGCCCTGGTTTAACTATACATGCACGTACGTGTGTGT	Y	7.30E-180	1.38E-14	Bradi2g62315.1.v3.1	mRNA	Degradome	GSE52441_panicle
Bd3	12620101	+	A The 20-nt upstream and downstream sequence around the modification site is shown below GTCCGACACGTGTCAGTTGGACCAGGAGAGGCTTGTGTTTA	i6A\|t6A	1.28E-33	9.06E-06	Bradi3g14150.1.v3.1.3UTR.1	3UTR	Degradome	GSE52441_stem
Bd3	12620106	+	G The 20-nt upstream and downstream sequence around the modification site is shown below ACACGTGTCAGTTGGACCAGGAGAGGCTTGTGTTTAGTGGT	m1G	1.24E-54	0.006307681	Bradi3g14150.1.v3.1	mRNA	Degradome	GSE52441_root
Bd4	7558565	-	T The 20-nt upstream and downstream sequence around the modification site is shown below GTCGAGTATGTGTTGGTTCATACTTACTTGTTTCAATGCGT	m1A\|m1I\|ms2i6A	7.18E-29	6.49E-05	Bradi4g08500.4.v3.1.3UTR.1	3UTR	Degradome	GSE52441_stem
Bd4	7558847	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CAAGCCTCCAGGCTGCGAGGAGTCCGGCAAGGCCTAAACAG	D	8.23E-18	0.000972544	Bradi4g08500.v3.1	mRNA	Degradome	GSE52441_stem
Bd4	7558850	-	A The 20-nt upstream and downstream sequence around the modification site is shown below CTTCAAGCCTCCAGGCTGCGAGGAGTCCGGCAAGGCCTAAA	D	2.90E-73	1.56E-06	Bradi4g08500.2.v3.1.CDS.2	exon	Degradome	GSE52441_stem
Bd4	7953787	+	T The 20-nt upstream and downstream sequence around the modification site is shown below AGCACAACAGCTCTCCTGGGTACTACGACGGGAGGTACTGG	D	1.42E-19	0.000972544	Bradi4g08800.1.v3.1.CDS.2	exon	Degradome	GSE52441_stem
Bd4	29414031	-	T The 20-nt upstream and downstream sequence around the modification site is shown below ACAACTTTTGGAATGGTGATTATCTTACTGTTTTAAATAAA	m1A\|m1I\|ms2i6A	2.58E-15	0.000691908	Bradi4g24367.1.v3.1.3UTR.1	3UTR	Degradome	GSE52441_panicle
Bd4	42333091	+	T The 20-nt upstream and downstream sequence around the modification site is shown below TCCGGGCATCTTTGTTCTTCTGCTCACTTGTTCATTTCTCT	D	5.29E-26	0.016981177	Bradi4g37210.1.v3.1	mRNA	Degradome	GSE52441_stem
Bd5	4950682	-	A The 20-nt upstream and downstream sequence around the modification site is shown below TCCCCATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTG	Y	9.93E-83	0.001449746	unanno_RNA	unanno_RNA	mRNAseq	SRR3286348
Bd5	15544108	+	T The 20-nt upstream and downstream sequence around the modification site is shown below TGCCATCCATGCCAAGCGGGTGACTATCATGCCCAAGGACA	D	1.46E-24	0.000691908	Bradi5g11920.4.v3.1.CDS.4	exon	Degradome	GSE52441_panicle
Bd5	25383928	-	T The 20-nt upstream and downstream sequence around the modification site is shown below AAAGTTCTGCCAGCTTTGATTAGCACTGTTCTCCTTGTCCA	m1A\|m1I\|ms2i6A	0	0	Bradi5g23150.1.v3.1.3UTR.1	3UTR	Degradome	GSE52441_root
Bd5	25383928	-	T The 20-nt upstream and downstream sequence around the modification site is shown below AAAGTTCTGCCAGCTTTGATTAGCACTGTTCTCCTTGTCCA	m1A\|m1I\|ms2i6A	2.57E-307	4.06E-10	Bradi5g23150.1.v3.1.3UTR.1	3UTR	Degradome	GSE52441_stem

Brachypodium distachyon mRNA modification sites

The 20-nt upstream and downstream sequence around the modification site is shown belowTAGGGTTCAACCATGTTTTACCGTCGGACTGTAGAACTTCG

The 20-nt upstream and downstream sequence around the modification site is shown belowCTAGGGTTCAACCATGTTTTACCGTCGGACTGTAGAACTTC

The 20-nt upstream and downstream sequence around the modification site is shown belowAAAGCTTAAGTAGCGGCTACTGTTTTGAATGCATCAATATA

The 20-nt upstream and downstream sequence around the modification site is shown belowTATCGTGTGGTCTTACTATCTATACTGGCGGAACGTCTCTT

The 20-nt upstream and downstream sequence around the modification site is shown belowTATCGTGTGGTCTTACTATCTATACTGGCGGAACGTCTCTT

The 20-nt upstream and downstream sequence around the modification site is shown belowGAGACAAGCATATGACTAGTGGCAGGATCAACCAGGTAGCA

The 20-nt upstream and downstream sequence around the modification site is shown belowGAGACAAGCATATGACTAGTGGCAGGATCAACCAGGTAGCA

The 20-nt upstream and downstream sequence around the modification site is shown belowATAGCTCGCAACTCCCTGTATGAAGAATGCATTCTTTCTAT

The 20-nt upstream and downstream sequence around the modification site is shown belowAAATCGCCCTGGTTTAACTATACATGCACGTACGTGTGTGT

The 20-nt upstream and downstream sequence around the modification site is shown belowGTCCGACACGTGTCAGTTGGACCAGGAGAGGCTTGTGTTTA

The 20-nt upstream and downstream sequence around the modification site is shown belowACACGTGTCAGTTGGACCAGGAGAGGCTTGTGTTTAGTGGT

The 20-nt upstream and downstream sequence around the modification site is shown belowGTCGAGTATGTGTTGGTTCATACTTACTTGTTTCAATGCGT

The 20-nt upstream and downstream sequence around the modification site is shown belowCAAGCCTCCAGGCTGCGAGGAGTCCGGCAAGGCCTAAACAG

The 20-nt upstream and downstream sequence around the modification site is shown belowCTTCAAGCCTCCAGGCTGCGAGGAGTCCGGCAAGGCCTAAA

The 20-nt upstream and downstream sequence around the modification site is shown belowAGCACAACAGCTCTCCTGGGTACTACGACGGGAGGTACTGG

The 20-nt upstream and downstream sequence around the modification site is shown belowACAACTTTTGGAATGGTGATTATCTTACTGTTTTAAATAAA

The 20-nt upstream and downstream sequence around the modification site is shown belowTCCGGGCATCTTTGTTCTTCTGCTCACTTGTTCATTTCTCT

The 20-nt upstream and downstream sequence around the modification site is shown belowTCCCCATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTG

The 20-nt upstream and downstream sequence around the modification site is shown belowTGCCATCCATGCCAAGCGGGTGACTATCATGCCCAAGGACA

The 20-nt upstream and downstream sequence around the modification site is shown belowAAAGTTCTGCCAGCTTTGATTAGCACTGTTCTCCTTGTCCA

The 20-nt upstream and downstream sequence around the modification site is shown belowAAAGTTCTGCCAGCTTTGATTAGCACTGTTCTCCTTGTCCA

The 20-nt upstream and downstream sequence around the modification site is shown below
TAGGGTTCAACCATGTTTTACCGTCGGACTGTAGAACTTCG

The 20-nt upstream and downstream sequence around the modification site is shown below
CTAGGGTTCAACCATGTTTTACCGTCGGACTGTAGAACTTC

The 20-nt upstream and downstream sequence around the modification site is shown below
AAAGCTTAAGTAGCGGCTACTGTTTTGAATGCATCAATATA

The 20-nt upstream and downstream sequence around the modification site is shown below
TATCGTGTGGTCTTACTATCTATACTGGCGGAACGTCTCTT

The 20-nt upstream and downstream sequence around the modification site is shown below
TATCGTGTGGTCTTACTATCTATACTGGCGGAACGTCTCTT

The 20-nt upstream and downstream sequence around the modification site is shown below
GAGACAAGCATATGACTAGTGGCAGGATCAACCAGGTAGCA

The 20-nt upstream and downstream sequence around the modification site is shown below
GAGACAAGCATATGACTAGTGGCAGGATCAACCAGGTAGCA

The 20-nt upstream and downstream sequence around the modification site is shown below
ATAGCTCGCAACTCCCTGTATGAAGAATGCATTCTTTCTAT

The 20-nt upstream and downstream sequence around the modification site is shown below
AAATCGCCCTGGTTTAACTATACATGCACGTACGTGTGTGT

The 20-nt upstream and downstream sequence around the modification site is shown below
GTCCGACACGTGTCAGTTGGACCAGGAGAGGCTTGTGTTTA

The 20-nt upstream and downstream sequence around the modification site is shown below
ACACGTGTCAGTTGGACCAGGAGAGGCTTGTGTTTAGTGGT

The 20-nt upstream and downstream sequence around the modification site is shown below
GTCGAGTATGTGTTGGTTCATACTTACTTGTTTCAATGCGT

The 20-nt upstream and downstream sequence around the modification site is shown below
CAAGCCTCCAGGCTGCGAGGAGTCCGGCAAGGCCTAAACAG

The 20-nt upstream and downstream sequence around the modification site is shown below
CTTCAAGCCTCCAGGCTGCGAGGAGTCCGGCAAGGCCTAAA

The 20-nt upstream and downstream sequence around the modification site is shown below
AGCACAACAGCTCTCCTGGGTACTACGACGGGAGGTACTGG

The 20-nt upstream and downstream sequence around the modification site is shown below
ACAACTTTTGGAATGGTGATTATCTTACTGTTTTAAATAAA

The 20-nt upstream and downstream sequence around the modification site is shown below
TCCGGGCATCTTTGTTCTTCTGCTCACTTGTTCATTTCTCT

The 20-nt upstream and downstream sequence around the modification site is shown below
TCCCCATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTG

The 20-nt upstream and downstream sequence around the modification site is shown below
TGCCATCCATGCCAAGCGGGTGACTATCATGCCCAAGGACA

The 20-nt upstream and downstream sequence around the modification site is shown below
AAAGTTCTGCCAGCTTTGATTAGCACTGTTCTCCTTGTCCA

The 20-nt upstream and downstream sequence around the modification site is shown below
AAAGTTCTGCCAGCTTTGATTAGCACTGTTCTCCTTGTCCA